search
Contact Us
HOME

  • Crossref logo
  • Crossref Similarity Check logo
Journal Search Engine

to

Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 1225-1577(Print)
ISSN : 2384-0900(Online)
The Korean Journal of Oral and Maxillofacial Pathology Vol.45 No.2 pp.49-57
DOI : https://doi.org/10.17779/KAOMP.2021.45.2.002

The Effect of Transglutaminase 2 on Proliferation, Migration and Invasion of Salivary Gland Tumor Cell Line

Tae Woong Ahn1), Chong Heon Lee2)*
1)Department of Oral and Maxillofacial Surgery, Sun Dental HospitalDepartment of Oral PathologyCollege of Dentistry, Oral Aging Research Center, Dankook University
2)Department of Oral PathologyCollege of Dentistry, Oral Aging Research Center, Dankook University
* Correspondence: Chong Heon Lee, Department of Oral Pathology, Dental College, Dankook University, Aseodong San 29, Cheonan, Chungnam, 330-714, Korea. Tel: +82-41-550-1946 Email: chleeop@naver.com
March 21, 2021 March 29, 2021 April 2, 2021

Abstract


Salivary gland adenocarcinoma(AdCa NOS) is one of the major causes of mortality among malignant salivary gland tumors. New therapeutic measure are needed to improve the outcome for patients with AdCa NOS because current therapy does not significantly improve survival rates. Transglutaminase 2(TGase 2) was implicated in forming cross-linked protein polymer, apoptosis and matrix interaction. And also TGase 2 expression is up-regulated in proliferation, migration, invasion, and metastasis of cancer cells. shRNA which has emerged as an effective method to target specific genes for silencing has provided new opportunities for cancer therapy. But there has been rarely reported using shRNA-TGase 2 transfection in AdCa NOS. The purpose of this study were to examine the specific inhibition of TGase 2 mRNA and protein expression by siRNA transfection of TGase 2 through RT-PCR and immunoslot blotting, and to study proliferation, migration and invasion assay of SGT cell line from AdCa NOS. Cell cycle analysis showed that the downregulation of shRNA-TGase 2 caused the accumulation of cells in the sub-G0/G1 phase. In migration assay, suppressing shRNA-TGase 2 inhibited the capacity of the cells to migrate compared to parental cells. In invasion assay, cells transfected with shRNA-TGase 2 decreased in invasion when compared to SGT and vector transfected cells. shRNA-TGase 2 expressing plasmids efficiently downregulated TGase 2 mRNA and TGase 2 protein expression. It suggested that the shRNA-TGase 2 targeting system against TGase 2 could have a therapeutic potentiality for malignant salivary gland tumors, especially in inhibiting and/or preventing cancer cell proliferation, migration and invasion.


Transglutaminase 2 , Salivary gland tumor cell line

타액선 종양 세포주의 증식, 이동 및 침습에 제 2형 트랜스글루타민아제가 미치는 영향

안 태웅1), 이 종헌2)*
1)선 치과병원 구강악안면외과학교실단국대학교 치과대학 구강병리학교실구강노화연구소
2)단국대학교 치과대학 구강병리학교실구강노화연구소

초록

    Ⅰ. INTRODUCTION

    Adenocarcinoma NOS(AdCa NOS) characterized by unique clinical features and behavior which is the third most common malignant tumor of the salivary glands shows a relatively unfavorable prognosis with high frequencies of recurrence and distant metastasis1-2). Because a substantial risk of local-regional recurrence and distant metastasis exists3-6) by the ability of malignant salivary gland tumor cells to invade surrounding tissues, long-term survival of patients with AdCa has only moderately improved during the past 30 years in spite of the advanced diagnosis and therapy7-12). Although the molecular mechanisms underlying tumor metastasis are a complex process, it is well known that migration of tumor cell can invade local tissues and metastasize to distal sites through ECM.

    Transglutaminases(TGaes; EC 2.3.2.13) are a family of enzymes that catalyze Ca2+-dependent protein transamidation. Transglutaminase 2(TGase 2), belonging to the TG superfamily, has functions beyond catalysis of protein transamidation. It also possesses GTPase, protein kinase, and protein disulfide isomerase activities13,14), and exhibits calcium-independent nonenzymatic activity for cell adhesion and signaling 13). Most TGase 2 proteins are localized intracellularly, but some are present on the cell surface and in the extracellular matrix13). Recently it is reported that TGase 2 multifunctionally participates in cell survival/apoptosis, adhesion, migration, differentiation, and inflammation13,14).

    Because TGase 2 is involved in carcinogenesis, TGase 2 expression is higher in tumor than in normal tissues in melanoma, pancreatic, and ovarian cancers15-19). And also higher TGase 2 expression positively correlated with the metastatic status in these cancer types and in breast cancer15,16,20) promotes invasion and drug resistance in various types of cancer cells15,16,19,21-23) through the induction of epithelial– mesenchymal transition(EMT)24).

    The recent discovery of RNA interference(RNAi), a more powerful tool for the inhibition of gene expression, has provided new opportunities for cancer therapy11,25-29). It was thought that shRNA-TGase 2 could play an important role in the downregulation mechanisms to characteristic features of AdCa. Unfortunately previous studies about the transfection effect of shRNA-TGase 2 on AdCa have been rarely reported.

    The purpose of this study were to examine downregulation of TGase 2 expression through shRNA transfection of TGase 2 in SGT cell line and to investigate the inhibition of proliferation activity, migration and invasion potentiality of SGT cell line.

    Ⅱ. MATERIALS and METHODS

    1. Cell Culture, siRNA-expressing Plasmid Construction and Transfections

    SGT cells were grown in Dulbecco’s modified Eagle's medium( DMEM, Hyclone USA) supplemented with 1% glutamine, 10% fetal bovine serum(pH 7.2–7.4) in a humidified atmosphere containing 5% CO2 at 37°C. Construction of short hairpin(sh) RNA-expressing plasmids were constructed as well described. The target sequence of shRNA-TGase 2 is 5-AAGGGCGAA CCACCTGAACAA-3. Transient Transfections were performed with Lipofectamine 2000 reagent(Invitrogen, USA). using 1-2 mg of expression vector/ml serum-free medium as described by the manufacturer. SGT cells were transfected with plasmids expressing shRNA targeting TGase 2 and vector(hU6-MCS-Ubquitin-EGFP-IRES-G418). After 5– 6hrs of transfection, the medium was replaced by serum- containing medium and incubated for a further 48hrs. Stable transfectants of SGT cells were selected and maintained in medium containing 700μg/ml of G418(Gibco).

    2. Cell Cycle Analysis

    SGT cells(1x106/ml) transfected with shRNA-TGase 2 and vector for 48 hrs and parental cells were analyzed. Cells were trypsinized, and fixed in chilled 70% ethanol for 12hrs. After washed with PBS for 3x5min, and resuspended in 200μl PBS. RNase A(100μl of 0.1% solution) was added to the cell suspensions followed by a 15min incubation at 37°C. Cells were treated with 50mg/mL propidium iodide( 0.001% RNAse A solution for 15 min) as per standard protocol. The cells were sorted on a fluorescence-activated cell sorter and quantified(10,000 cells sorted per treatment condition with 3 replications, p<0.05).

    3. Cell Migration Assay

    A modified Boyden chamber was used for the cell migration assay, as described previously with slight modifications. The chamber(Falcon, USA) consisted of upper and lower compartments separated by a polyethylene terephthalate track-etched filter(6.4mm diameter) with 8mm pores. The lower side of the filter was coated overnight with 10mg/ml of VN coating or BSA and then blocked with 3% BSA for 1h at room temperature. The lower compartment of the chamber was filled with 700ml of serum free medium containing 0.1% BSA and 10mg/ml of type IV collagen. A 200ml aliquot of suspended cells including parental, vector and siRNA-TGase 2 transfected cells(1x105 cells in serum-free medium containing 0.1% BSA) was placed in the upper compartment of the chamber. After a 12hrs incubation at 37°C, cells that migrated to the lower side of the filter were quantified by light microscopy under a high power field(x200). For each of the triplicate experiments, cells in five randomly chosen fields were counted, and averaged( p<0.05).

    4. Cell Invasion Assay

    The in vitro invasiveness of SGT cells in the presence of the vector expressing siRNA for TGase 2 was assessed using a modified Boyden chamber assay. A cell invasion assay was conducted with QCM96-well cell invasion assay kit(Corning Costar Fisher Scientific, USA). This well invasion plate is based on the Boyden chamber principle. This plate contains 96 inserts; each containing an 8um pore size polycarbonate membrane coated with a layer of ECMatrix. Briefly, parental, vector and siRNA-TGase 2 transfected cells, respectively, were resuspended in serum free DMEM, and 5x104 cells were seeded into the ECM layer, which had been previously rehydrated at room temperature for 1–2hrs. 150μl DMEM containing 10% FBS was added to the lower chamber as chemoattractant. Cells were incubated for 24hrs at 37°C in 5% CO2 incubator. Invaded cells on the bottom of the insert membrane were dissociated from the membrane by incubation with cell detachment buffer and subsequently lysed and detected by a fluorescence plate leader. The fluorescence was quantified with a fluorescence plate reader using a 485/535-nm filter set(p<0.05).

    5. RT-PCR

    Total RNA was extracted from parental, vector and siRNA-TGase 2 transfected cells with the TRIzol reagent( Life Technologies, USA) according to the manufacturer's instructions. To avoid DNA contamination, total RNA was treated with RNase-free DNase I(Takara, Japan) for 60min at 37°C, and extracted with the TRIzol reagent again. Takara Ex Taq DNA polymerase(Takara, Japan) were used for the PCR. Then the RNA was reverse transcribed at 42°C for 60min in a 20μl reaction volume using a First Strand cDNA synthesis kit(Clontech Lab, USA), according to the manufacturer’ instructions. cDNA was incubated at 95°C for five minutes to inactivate the reverse transcriptase, and used as template DNA in the PCR amplification of the TGase 2 region. The conditions comprised an initial denaturation step at 94°C for 1min, then 45 cycles at 94°C for 10s, 55°C for 30s and 72°C for 1min and finally a extension step at 72°C for 5min with 32P-dCTP labeling using PCR machine. As an internal control of each sample, Human β-actin gene was used for standardization, and the amplification was quantified in duplicate. The PCR primer and probes sequences used in this study was TGase 2(Sense : CTCGTGGAGGCA GTTATCAACAGCTAC, Antisense : TCTCGAAGTTCACCACCAGCTTGTG), TG2 siRNA (5’-AAGGGCGAACCACCTGAACAA-3’) and Human β-actin as positive control(sense : ATCTGGCACCACACCTTCTACAATGAGCTGGG, antisense : CG TCATACTCCTGCTTGCTGATCCACATCTGC).

    Each PCR product was electrophoresed on an agarose gel to confirm that there was only one band with the expected size for the target gene. The quantification of mRNA expression was determined by densitometric analysis. All the PCR products were analyzed comparatively to the amount of human β-actin detected in the same mRNA sample. mRNA expression of TGase 2 was used to prepare a standard graph. Data were representative of three experiments. For each experiment, triplicate cultures were used; the results were the means of three independent experiments. The TGase 2 and gene expression levels were evaluated semi-quantitatively(p<0.05).

    6. Sample Preparation for TGase assay

    2x104 cells were plated in triplicate at 60mm dish in condition medium. In preconfluency(80%), the parental and transfected cells were harvested with 0.1M Tris-acetate(pH 7.5), 1mM EDTA, containing protease inhibitors. The homogenates were centrifuged at 10,000xg for 30min at 4°C. The supernatant(the soluble fraction) was taken.

    7. Conditions for TGase Assay

    To determine the enzyme activity by measurement of incorporation of [1,4]14C-putrscine into succinylated casein, the samples were mixed in reaction mixture(0.5ml) containing 0.1M Tris-acetate(pH 7.5), 1% succinylated casein, 1mM EDTA, 10mM CaCl2, 0.5% lubrol PX, 5mM DTT, 0.15M NaCl & 0.5mCi of 14C-putrscine(118pi/mole), which were incubated at 37°C for 1hr and terminated by addition of 4.5ml of cold(4°C) 7.5% TCA. The TCA-insoluble precipitates were collected onto GF/A glass fiber filters washed with cold 5% TCA, dried and counted. The aboving methods were 3 times repeated, and TGase 2 level was calculated(p<0.05).

    8. Immunoslot blot

    SGT cells were transfected with vector and shRNA-TGase 2 for 72 hours. Then, cells including parental cells were collected, and total cell lysates were prepared in 0.1M Tris-acetate( pH 7.5), 1mM EDTA, protease inhibitors. Protein amount of those extracts was quantified at 495nm with spectro- photometer, serially diluted in the range of 10μg to 1μg, and applied into slot chambers containing nitrocellulose membrane. Slot chambers were twice washed with TBS. The membrane was processed as the following western blotting methods. The membrane was treated with blocking serum, incubated with primary antibodies and secondary antibodies. The antibodies for the antigens were purchased from the following sources: actin(clone AC-15, Sigma) and TGase 2(Santacruz, USA) commercially available. This was developed by an enhanced cheminoluscence( ECL) method, and examined by densitometer in triplicate(p<0.05). The protein concentrations were determined by Bio-Rad Protein Assay and other extracts were stored at 80°C.

    Ⅲ. RESULTS

    TGase 2 has been implicated in metastasis of various cancer types. To elucidate its role in cell cycle analysis, migration and invasion of SGT cells, we used SGT cell line isolated from a human salivary gland adenocarcinoma through progressive in vitro screening. To determine if TGase 2 promoted cell invasion, we established the stable SGT cell line expressing TGase 2, empty vector and shRNA-TGase 2, respectively. SGT cells transfected with shRNA expressing plasmids were isolated.

    From the results of FACS analysis, simultaneous downregulation of TGase 2 caused a higher accumulated cells in the sub-G0/G1 phase in shRNA-TGase 2 in SGT cells as compared to downregulation of control(about 30%) and vector(about 30%). Control and vector cells had very little accumulated cells in the sub-G0/G1 phase(Fig. 1), while quantitative analysis indicated that SGT cells transfected with shRNA-TGase 2(about 58%) had increased accumulated cells in the sub-G0/G1 phase. Cell death in shRNA-TGase 2 transfected cells was found to be more than about 50%(Fig. 1). It suggested that suppression of TGase 2 expression in shRNA-TGase 2 transfected cells could cause the accumulated cells in the sub-G0/G1 phase.

    In a migration assay, cells transfected with shRNA-TGase 2 showed a significantly lower migration capability to vitronectin as compared to control and vector cells(Fig. 3), and showed about 75% migration activity compared to parental and vector cells(Fig. 3). It suggested that suppressing TGase 2 could inhibit the capacity of the cells to migrate on vitronectin.

    For invasion assay, no significant difference was observed in parental and vector cells. Quantitative analysis revealed that invasion decreased by about 33% in SGT cells after shRNA-TGase 2 transfection when compared to all other treatment conditions(Fig. 2). As shown in Figure 2, 3, shRNA-TGase 2 effectively reduced TGase 2 expression, and this caused a decrease in the migratory and invasive abilities. Collectively, these results suggested that TGase 2 might promote migration and invasion of SGT cells.

    To verify whether the TGase 2 gene was silencing by vector construct expressing, TGase 2 mRNA expression of parental and transfected cells were detected by RT-PCR. Using specific primers for TGase 2 and human β-actin(control) in SGT cells, there was no reduction in the mRNA levels of TGase 2. Cells transfected with shRNA-TGase 2 showed significantly reduced about 1/2 fold TGase 2 mRNA expression( Fig. 4,5) as compared to control cells, respectively. It suggested that the TGase 2 gene might be silenced by RNA inference.

    Cells transfected with shRNA-TGase 2 had decreased about 1/4 fold TGase 2 enzyme activity(Fig. 6). Expression of TGase 2 in these cells was confirmed by immunoblotting. TGase 2 protein expression decreased by about 1/3 fold in shRNA-TGase 2 transfected cells as compared to the controls( Fig. 7,8). By examination of TGase 2 protein expression in these cells TGase 2 protein levels were substantially lower in shRNA-TGase 2 transfected cells than in control cells(Fig. 7,8), implying a positive correlation between TGase 2 expression, and cell migration and invasiveness. It suggested that plasmids expressing shRNA targeting TGase 2 could suppress TGase 2 enzyme activity and protein levels in SGT cells.

    Ⅳ. DISCUSSION

    TGase 2 is a multifunctional protein with inside and outside location13,30), and its overexpression has been implicated in carcinogenesis14).

    From FACS analysis, we did observe the accumulation of cells in the sub-G0/G1 phase in transfected cells downregulated for TGase 2. To target TGase 2, we used plasmids expressing shRNA targeting TGase 218). In this study, SGT cells transfected with shRNA-TGase 2 displayed markedly inhibited proliferation.

    In agreement with previous findings of another tumors 27,29), TGase 2 overexpression in SGT cells enhanced cell migration and invasion, while silenced TGase 2 expression in shRNA-TGase 2 showed inhibitory effect on cell migration and invasion. Here these results showed that the expression of TGase 2 was positively correlated with migration and invasion of SGT cells. The effect of TGase 2 on these events might partly rely on its function outside the cell to augment migration and invasion. Thus, It suggested that TGase 2 might play a role in promoting metastasis of SGT cell by facilitating cell migration and invasion. TGase 2 in intracellular and cell surface have been documented to promote metastasis. Intracellular TG2 activates NF-kB, leading to expression of HIF-1, which in turn induces EMT by stimulating expression of EMT regulators32,33). Thus cancer cells undergoing EMT acquire the ability to metastasize 32,33).

    This process requires the GTP-binding activity but not the transamidase activity of TGase 234). To examine if the protein transamidase activity of TGase 2 is required for cell migration and invasion, TGase 2 enzyme activity assay was done. Although TG enzyme activity assay assured that SGT cells showed higher activity, it was reported that the transamidase activity of TGase 2 was not required for migration and invasion of lung cancer cells29). Extracellular TG2 proteins are localized on the cell surface and in the extracellular matrix. In cancer cells, TGase 2 expression associated with b1, b3, and b5 integrins, positively correlates with cell adhesion, migration, and invasion17,22) independent of the transamidase activity of TGase 216,22,34). It suggested that consistent with other reports, TGase 2 promoted migration and invasion in SGT cells independent of TGase 2 enzyme activity.

    TGase 2 in the extracellular matrix which cross-links matrix proteins to enhance their stability and rigidity affects cell proliferation and invasion14.28). Recently TGase 2 influences tumor mesenchyme by enhancing deposition and cross-linking of collagen and activating mesenchymal fibroblasts, leading to tumor growth and chemoresistance9,19). It thought that SGT cells with greater amounts of TGase 2 in this culture medium as extracellular condition increased migration and invasion. Application of recombinant TGase 2 protein to cells in a dose-dependent manner substantially augments migration and invasion, suggesting that extracellular TGase 2 is fairly sufficient to confer invasion35) and metastasis of lung and ovarian cancer17).

    TGase 2 promoted migration and invasion by increasing focal adhesion kinase(FAK), Akt, NF-kB, Rac GTPase activity in various cancer cells20,23,35-38). And also the metastasis mechanism of tumor stimulated by TGase 2 has been involved in its induction of EMT4 mediated by NF-kB and Akt20,34,36,39). On the basis of these results, SGT cells with higher TGase 2 expression greatly increased migration and invasion, and a secreted TGase 2 in culture medium could play a role in these events by a signaling molecule as GTPase involved in cell adhesion and migration as well as tumor metastasis, being upregulated by TGase 229,40).

    The aboving results revealed a significant role of TGase 2 in promoting proliferation, migration and invasion of SGT cells. Owing to its multiple localizations and diverse functions, it suggested that TGase 2 might influence various responses during AdCa development. Hence, targeting TGase 2 gene would be a means to inhibit tumor metastasis as it is more accessible to therapeutic agents because identification and inhibition of metastasis-related genes might help devise strategies for cancer therapy in future.

    Figure

    KAOMP-45-2-49_F1.gif

    Cell cycle analysis of Control, Vector and shRNA-TGase 2.

    KAOMP-45-2-49_F2.gif

    Invasion Assay of Control, Vector and shRNA-TGase 2.

    KAOMP-45-2-49_F3.gif

    Migration Assay of Control, Vector and shRNA-TGase 2.

    KAOMP-45-2-49_F4.gif

    SGT mRNA expression in Control, Vector and shRNA-TGase 2.

    KAOMP-45-2-49_F5.gif

    SGT mRNA expression Measurement in Control, Vector and shNA- TGase 2 by Densitometer.

    KAOMP-45-2-49_F6.gif

    TGase 2 Enzyme Activity of Control, Vector and shRNA-TGase 2.

    KAOMP-45-2-49_F7.gif

    SGT Protein Expression of Control, Vector and shRNA-TGase 2 by Immunoslot blot.

    KAOMP-45-2-49_F8.gif

    SGT Protein Expression Measurement of Control, Vector and shRNA-TGase 2 by Immunoslot blot with Densitometer.

    Table

    Reference

    1. Ellis GL, Auclair PL, Gnepp DR: Surgical pathology of the salivary glands. Philadelphia, WB Saunders CO., 1991:129-134, 318-332.
    2. Neville BW: Oral and maxillofacial pathology. Saunders CO., 2015:465-466.
    3. Barnes L: Surgical pathology of the head and neck. Marcel Dekker Inc., 1986:533-646.
    4. Spiro RH: Salivary neoplasms: Overview of a 35-year exper iencewith 2807 patients. Head Neck Surg 1986;8:177–184.
    5. Spiro RH, Armstrong J, Strong EW: Carcinoma of major salivary glands. Recent trends. Arch Otolaryngol Head Neck Surg 1989;115:316–321.
    6. Kane WJ, McCaffrey TV, Lewis JE: Primary parotid malignancies. A clinical and pathologic review. Arch Otolaryngol Head Neck Surg 1991;117:307–315.
    7. Lee CH: Apoptotic effect of taxol on SGT cell line. Kor J Oral Maxillofac Pathol 2008;32:139-142.
    8. Lee BH, Lee CH: Manumycin A induced apoptotic effect on SGT cell line by caspase activation. Kor J Oral Maxillofac Pathol 2007;31:327-336.
    9. Lee CH: The effect of cyclosporine A on the proliferation and differentiation of SGT cell line. Kor J Oral Maxillofac Pathol 2009;33:347-352.
    10. Kim IS, Lee CH: Transgluraminase 2 expression was associated with nuclear factor kappa in salivary gland tumor cell line. Kor J Oral Maxillofac Pathol 2010;34:57-64.
    11. Chung YJ, Lee CH: miRNA155 inhibitory effect on the proliferation and invasion of salivary gland tumor cell line. Kor J Oral Maxillofac Pathol 2014;38:373-380.
    12. Chung WH, Lee CH: Docetaxel induces apoptosis in salivary gland tumor cell line. Kor J Oral Maxillofac Pathol2017;41:113-120.
    13. Nurminskaya MV, Belkin AM: Cellular functions of tissue trans-glutaminase. Int Rev Cell Mol Biol 2012;294:1–97.
    14. Eckert RL, Kaartinen MT, Nurminskaya M, Mehta K: Transglutaminase regulation of cell function. Physiol Rev 2014;94:383–417.
    15. Fok JY, Ekmekcioglu S, Mehta K: Implications of tissue transglutaminase expression in malignant melanoma. MolCancer Ther 2006;5:1493–1503.
    16. Verma A, Wang H, Kumar R, Mehta K: Increased expression of tissue transglutaminase in pancreatic ductal adenocarcinoma and its implications in drug resistance and metastasis. Cancer Res 2006;66:10525–10533.
    17. Satpathy M, Cao L, Pincheira R, Emerson R, Bigsby R, Nakshatri H, Matei D: Enhanced peritoneal ovarian tumor dissemination by tissue transglutaminase. Cancer Res 2007;67:7194–7202.
    18. Chun YG, Lee CH: Transglutaminase 2 mRNA expression in salivary gland tumor cell line. J KDS 2013;6:22-26.
    19. Lee J, Condello S, Yakubov B, Emerson R, Hitomi K, Xie J, Matei D: Tissue transglutaminase mediated tumor-stroma interaction promotes pancreatic cancer progression. ClinCancer Res 2015;21:4482–4493.
    20. Yakubov B, Chelladurai B, Schmitt J, Emerson R, Turchi JJ, Matei D: Extracellular tissue transglutaminase activates noncanonical NF-kB signaling and promotes metastasis in ovarian cancer. Neoplasia 2013;15:609–619.
    21. Herman JF, Mangala LS, Mehta K: Implications of increased tissue transglutaminase(TG2) expression in drug-resistant breast cancer (MCF-7) cells. Oncogene 2006;25:3049–3058.
    22. Mangala LS, Fok JY, Zorrilla-Calancha IR, Verma A, Mehta K: Tissue transglutaminase expression promotes cell attachment, nvasion and survival in breast cancer cells. Oncogene 2007;26:2459–2470.
    23. Cao L, Petrusca DN, Satpathy M, Nakshatri H, Petrache I, Matei D: Tissue transglutaminase protects epithelial ovarian cancer cells from cisplatin-induced apoptosis by promotingcell survival signaling. Carcinogenesis 2008;29:1893–900.
    24. Shao M, Cao L, Shen C, Satpathy M, Nakshatri H, Matei D: Epithelial- to-mesenchymal transition and ovarian tumor progression induced by tissue transglutaminase. Cancer Res 2009;69:9192–201.
    25. Elbashir SM, Harborth J, Weber K, Tuschl T: Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001;24411:494-498.
    26. Westhof E, Filipowicz W: From RNAi to epigenomes: How RNA rules the world. Chem Biochem 2005;6:441–443.
    27. Wang X, Wu X, Zhu Z, Liu B, Su L: Tissue transglutaminase- 2 promotes gastric cancer progression via the ERK1/2 pathway. Oncotarget 2015;7:7066-7079.
    28. Farra R, Rizzolio F, Grassi G, Dapas B: Polymer-mediated delivery of siRNAs to hepatocellular carcinoma: Variablesaffecting specificity and effectiveness. Molecules 2018;28;23.
    29. Lee HT, Chao YL, Wu YY, Lee YJ: Trans- glutaminase 2 promotes migration and invasion of lung cancer cells.Oncology Research 2018;26:1175-1182.
    30. Park D, Choi SS, Ha KS: Transglutaminase 2: A multifunctional protein in multiple subcellular compartments. Amino Acids 2010;39:619-631.
    31. Chu YW, Yang PC, Yang SC, Shyu YC, Hendrix MJ, Wu R, Wu CW: Selection of invasive and metastatic subpopulations from a human lung adenocarcinoma cell line. Am J Respir Cell Mol Biol 1997;17:353-360.
    32. Kumar A, Xu J, Yu D, Reuben J, Mehta K: Tissue transglutaminase promotes drug resistance and invasion by inducing mesenchymal transition in mammary epithelial cells. PLoS One 2010;5:e13390.
    33. Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest 2009;119:1420-1428.
    34. Kumar A, Xu J, Sung B, Kumar S, Yu D, Aggarwal BB, Mehta K: Evidence that GTP-binding domain but not catalytic domain of transglutaminase 2 is essential for epithelial- to-mesenchymal transition in mammary epithelial cells. Breast Cancer Res 2012;14:R4.
    35. Verma A, Guha S, Wang H, Fok JY, Koul D, Abbruzzese J, Mehta K: Tissue transglutaminase regulates focal adhesion kinase/AKT activation by modulating PTEN expression in pancreatic cancer cells. Clin Cancer Res 2008;14:1997-2005.
    36. Kumar S, Mehta K: Tissue transglutaminase constitutively activates HIF-1a promoter and nuclear factor-kB via a non-canonical pathway. PLoS One 2012;7:e49321.
    37. Toth B, Garabuczi E, Sarang Z, Melino G, Szondy Z: Transglutaminase 2 is needed for the formation of an efficient phagocyte portal in macrophages engulfing apoptotic cells. J Immunol 2009;182:2084-2092.
    38. Tong L, Yeo HL, Riau A, Chaurasia SS, Lim CT, Yiu TW, Iismaa SE: Molecular mechanism of transglutaminase-2 incorneal epithelial migration and adhesion. Biochim Biophys Acta 2013;1833:1304-1315.
    39. Lin CY, Tsai PH, Cheng CH, Huang CJ, Lee PP, Hwang JJ, Lee MT: Role of tissue transglutaminase 2 in the acquisition of a mesenchymallike phenotype in highly invasive A431 tumor cells. Mol Cancer 2011;10:87.
    40. Mack NA, Whalley HJ, Castillo-Lluva S, Malliri A: The diverse roles of Rac signaling in tumorigenesis. Cell Cycle 2011;10:1571-1581.
    Copyright © Korean Association of Oral and Maxillofacial Pathology. All rights reserved.
    오늘하루 팝업창 안보기 닫기