Ⅰ. INTRODUCTION

Adenocarcinoma NOS(AdCa NOS) is the third most common malignant tumor of the salivary glands which is characterized by unique clinical features and behavior, including a relatively unfavorable prognosis with high frequencies of recurrence and distant metastasis^1-2). Despite advances in diagnosis and therapy, long-term survival of AdCa patients has only moderately improved during the past 20 years. Although the standard treatment for major malignant salivary gland tumor is surgical resection, a substantial risk of localregional recurrence and distant metastasis exists^3–6) because of the ability of malignant salivary gland tumor cells to invade surrounding tissues.

Although the molecular mechanisms underlying metastasis are complex, it is clear that migration of tumor cell can invade local tissues and metastasize to distal sites through ECM. Migrating cells use both adhesion molecules and proteolytic enzymes to regulate their interaction with and response to the ECM. One protease system intimately connected to integrins is the urokinase-type plasminogen activator(uPA)/uPA receptor(uPAR)/ plasmin system⁷⁾ in inhibiting the characteristic feature of malignant tumor. Recently it is presented that the involvement of the uPA/uPAR system in chemotaxis and in the activation of intracellular signalling pathways lead to increased cellular proliferation, adhesion, and migration^8-11). Therefore, uPAR/uPA system is a potential target for therapy in patients with malignant salivary gland tumor. Although adjuvant chemotherapy and radiation has been used in previous studies in order to prevent the local-regional and distant metastatic failure rate^12-14), the high rate of survival rates has not been improved by these therapy.

The recent discovery of RNA interference(RNAi), a more powerful tool for the inhibition of gene expression, has provided new opportunities for cancer therapy^15-16). It was thought that RANi-uPAR/uPA could play an important role in the downregulation mechanisms to characteristic features of AdCa. Unfortunately previous studies about the transfection effect of RNAi-uPAR/uPA on AdCa have been rarely reported.

The purpose of this study were to examine downregulation of uPAR/uPA expression through RNAi transfection of uPAR/uPA in SGT cell line and to investigate the inhibition of proliferation activity, adhesion, migration and invasion potentiality of SGT cell line in vitro.

Ⅱ. MATERIALS AND METHODS

1. Cell Culture, RNAi-expressing Plasmid Construction and Transfections

SGT cells were grown in Dulbecco’s modified Eagle’'s medium (DMEM, Hyclone USA) supplemented with 1% glutamine, 10% fetal bovine serum(pH 7.2–7.4) in a humidified atmosphere containing 5% CO₂ at 37°C. Construction of short hairpin RNA-expressing plasmids were constructed as well described¹⁷⁾. Transfections were performed with Lipofectaminet 2000 reagent(Invitrogen, USA). using 1-2 mg of expression vector/ml serum-free medium as described by the manufacturer. After 5–6hrs of transfection, the medium was replaced by serumcontaining medium and incubated for a further 48hrs. SGT cells were transfected with plasmids expressing RNAi targeting uPAR(RNAi-uPAR), uPA (RNAi-uPA), and uPAR–uPA simultaneously (RNAi-uPAR/uPA).

2. Cell Adhesion Assay

A standard static adhesion assay was carried out using a 96-well microtiter plate coated with 10mg/ml of type IV collagen or BSA. A suspensions(2X10⁴cells/well) of parental and RNAi-uPAR-, RNAi-uPA-, RNAi- uPAR/uPA-transfected cells, respectively, were added to the wells and allowed to adhere at 37°C for 60 min. The wells were washed three times with PBS at room temperature. Attached cells were fixed and stained with 0.2% crystal violet in 10% ethanol and lysed in solubilization buffer. The absorbance was measured at 590 nm with a microplate reader.

4. Cell Migration Assay

A modified Boyden chamber was used for the cell migration assay, as described previously with slight modifications. The chamber(Falcon, USA) consisted of upper and lower compartments separated by a polyethylene terephthalate track-etched filter (6.4mm diameter) with 8mm pores. The lower side of the filter was coated overnight with 10mg/ml of VN coating or BSA and then blocked with 3% BSA for 1h at room temperature. The lower compartment of the chamber was filled with 700ml of serum free medium containing 0.1% BSA and 10mg/ml of type IV collagen. A 200ml aliquot of suspended cells including parental and RNAi-uPAR-, RNAi-uPA-, RNAiuPAR/ uPA-transfected cells(1x10⁵ cells in serum-free medium containing 0.1% BSA) was placed in the upper compartment of the chamber. After a 12hrs incubation at 37°C, cells that migrated to the lower side of the filter were quantified by light microscopy under a high power field(x200). For each of the triplicate experiments, cells in five randomly chosen fields were counted, and averaged.

5. Cell Invasion Assay

The in vitro invasiveness of SGT cells in the presence of the vector expressing siRNA for uPAR and uPA was assessed using a modified Boyden chamber assay. A cell invasion assay was conducted with QCM96-well cell invasion assay kit(Corning Costar Fisher Scientific, USA). This well invasion plate is based on the Boyden chamber principle. This plate contains 96 inserts; each containing an 8um pore size polycarbonate membrane coated with a layer of ECMatrix. Briefly, parental and RNAi-uPAR-, RNAi-uPA-, RNAi-uPAR/ uPA-transfected cells, respectively, were resuspended in serum free DMEM, and 5x10⁴ cells were seeded into the ECM layer, which had been previously rehydrated at room temperature for 1–2hrs. 150μl DMEM containing 10% FBS was added to the lower chamber as chemoattractant. Cells were incubated for 24hrs at 37°C in 5% CO₂ incubator. Invaded cells on the bottom of the insert membrane were dissociated from the membrane by incubation with cell detachment buffer and subsequently lysed and detected by a fluorescence plate leader. The fluorescence was quantified with a fluorescence plate reader using a 485/535-nm filter set.

5. in vitro Angiogenic Assay

SGT cells(2x10⁶/well) were seeded and transfected with RNAi-uPAR, RNAi-uPA, or RNAi-uPAR/uPA. After a 24-hour incubation period, the conditioned medium was removed and added to a 4x10⁴ human dermal endothelial cell in 8-well chamber slides. Cells were allowed to grow for 72 hours. Cells were then fixed in 3.7% formaldehyde and H&E stained to visualize capillary network formation. The degree of angiogenesis was quantified based on the numerical value for the product of the number of branches and number of branch points as an average of 10 fields. The results are graphically represented.

6. Cell Cycle Analysis

SGT cells (1x10⁶/ml) were transfected with RNAi-uPAR, RNAi-uPA, or RNAi-uPAR/uPA for 48 hours. Cells were trypsinized, and fixed in chilled 70% ethanol for 12 h. After washed with PBS for 3x5 min, and resuspended in 200 ul PBS. RNase A(100 ul of 0.1% solution) was added to the cell suspensions followed by a 15-min incubation at 37°C. Cells were treated with 50 mg/mL propidium iodide(0.001% RNAse A solution for 15 min) as per standard protocol. The cells were sorted on a fluorescence-activated cell sorter and quantified (10,000 cells sorted per treatment condition with 3 replications).

7. RT-PCR

Total RNA was extracted from parental and RNAi-uPAR-, RNAi-uPA-, RNAi-uPAR/uPA-transfected cells with the TRIzol reagent(Life Technologies, USA) according to the manufacturer’'s instructions. To avoid DNA contamination, total RNA was treated with RNase-free DNase I(Takara, Japan) for 60min at 37°C, and extracted with the TRIzol reagent again. Takara Ex Taq DNA polymerase(Takara, Japan) were used for the PCR. Then the RNA was reverse transcribed at 42°C for 60min in a 20μl reaction volume using a First Strand cDNA synthesis kit(Clontech Lab, USA), according to the manufacturer’ instructions. cDNA was incubated at 95°C for five minutes to inactivate the reverse transcriptase, and used as template DNA in the PCR amplification of the uPAR region. The conditions comprised an initial denaturation step at 94°C for 1min, then 45 cycles at 94°C for 10s, 55°C for 30s and 72°C for 1min and finally a extension step at 72°C for 5min with ³²P-dCTP labeling using PCR machine. As an internal control of each sample, Human β-actin gene was used for standardization, and the amplification was quantified in duplicate. The PCR primer and probes sequences used in this study was uPAR(sense : TTACCTCGAATGCATTTCCT, antisense : TTG CACAGCC TCTTACCATA), uPA(sense : TGCGTCCTGGTCG TGAGCGA, antisense : CAAGCGTGTCAGCGCT GTAG) and Human β-actin(sense : GTGGGGCGC CCCAGGCACCA, antisense : CTCCTTAATG TCACGCACGATTTC). Each PCR product was electrophoresed on an agarose gel to confirm that there was only one band with the expected size for the target gene. The quantification of mRNA expression was determined by densitometric analysis. All the PCR products were analyzed comparatively to the amount of human β-actin detected in the same mRNA sample. mRNA expression of uPAR was used to prepare a standard graph. Data were representative of three experiments. For each experiment, triplicate cultures were used; the results were the means of three independent experiments. The uPAR and uPA gene expression levels were evaluated semi-quantitatively.

8. Immunoslot blot

SGT cells were transfected with RNAi-uPA, RNAi-uPAR, or RNAi-uPAR/uPA for 72 hours. Then, cells were collected, and total cell lysates were prepared in 0.1M Tris-acetate(pH 7.5), 1mM EDTA, protease inhibitors. Protein amount of those extracts was quantified at 495nm with spectrophotometer, serially diluted in the range of 10μg to 1μg, and applied into slot chambers containing nitrocellulose membrane. Slot chambers were twice washed with TBS. The membrane was processed as the following western blotting methods. The membrane was treated with blocking serum, incubated with primary antibodies and secondary antibodies. The antibodies for the antigens were purchased from the following sources: are uPAR and uPA as per standard protocols(Santa Cruz Biotechnology), and cleaved caspase 8(Cell Signaling Technology) commercially available. This was developed by an enhanced chemino luscence(ECL) method, and examined by densitometer in triplicate. The protein concentrations were determined by Bio-Rad Protein Assay.

Ⅲ. RESULTS

In adhesion assay, cells transfected with RNAi-uPAR/uPA inhibited markedly adhesion to vitronectin compared to parental cells, and showed about 10% adhesion activity compared to parental cells, while cells transfected with RNAi-uPA showed about 30%, and cells transfected with RNAi-uPAR showed about 20%(Fig. 1).

For invasion assay, no significant difference was observed in control cells. Quantitative analysis revealed that invasion decreased by 33% in SGT cells after RNAi-uPAR transfection. Cells transfected with RNAi-uPA showed similar decreases in invasion(31%). Cells transfected with RNAi-uPAR/uPA showed the maximum decrease in invasion(60%) when compared to all other treatment conditions (Fig. 2).

In a migration assay, cells transfected with RNAi-uPAR/ uPA showed a significantly lower capability of cells to migrate to vitronectin as compared to parental cells(Fig. 3), and showed about 25% migration activity compared to parental cells(Fig. 3), while cells transfected with RNAi-uPA showed about 75%, and cells transfected with RNAi-uPAR showed about 60%. It suggested that suppressing uPAR and uPA could inhibit the capacity of the cells to migrate on vitronectin.

Endothelial cells formed dense capillary-like structures when cultured with conditioned media from untransfected SGT cells, while endothelial cells grown in conditioned media of SGT cells transfected with RNAi-uPAR or RNAi-uPA showed a decrease in the density and completeness of the capillary network structure(broken and rudimentary network formation) as compared to the controls. Quantitative analysis indicated that transfection with RNAi-uPAR(46%) or RNAi-uPA(38%) decreased capillary network formation(controls considered as 100% angiogenic). Transfection with RNAi-uPAR/uPA(73%) caused the most significant decrease in endothelial cell network formation. It suggested that suppression of uPAR and uPA expression in SGT cells could retard their angiogenic potential in vitro.

To verify whether the uPAR and uPA gene was silencing by vector construct expressing RNAi, uPAR and uPA mRNA expression of parental and RNAi-uPAR transfected cells were detected by RT-PCR. Using specific primers for uPAR, uPA and human β-actin in SGT cells, there was no reduction in the mRNA levels of uPAR. Cells transfected with RNAiuPAR and RNAi-uPA showed significantly reduced uPAR and uPA mRNA expression(Fig. 5,6), Figure 2A shows a 1/4 fold decrease in the mRNA levels of uPAR in RNAi-uPAR transfected cells and a significant(1/2 fold) decrease in the mRNA levels of uPA in RNAi-uPA, while 1/8 fold of uPAR mRNA level and 1/4 fold of uPA mRNA level in RNAi-uPAR/ uPA-transfected cells when compared to control cells, respectively. It suggested that the uPAR and uPA gene might be silenced by RNA inference.

uPAR protein expression decreased by about 1/2 fold in RNAi-uPAR-transfected cells and about 1/5 fold in RNAiuPAR/ uPA-transfected cells as compared to the controls(Fig. 7,8). Cells transfected with RNAi-uPA had decreased about 0.4 fold uPA activity but about 1/4 fold in uPA expression levels in RNAi-uPAR/uPA-transfected cells(Fig. 2B). It suggested that plasmids expressing RNAi targeting uPAR and uPA could suppress uPAR and uPA protein levels in SGT cells.

From the results of FACS analysis, simultaneous downregulation of uPAR and uPA caused a higher accumulation of cells in the sub-G0/G1 phase in SGT cells as compared to downregulation of either uPAR or uPA alone. Controls cells had very little accumulation of cells in the sub-G0/G1 phase(Fig. 3B), while quantitative analysis indicated that SGT cells transfected with RNAi-uPAR(35%) or RNAi-uPA(29%) had increased accumulation of cells in the sub-G0/G1 phase. Cell death in RNAi-uPAR/ uPA-transfected cells(57%) was found to be more than 50% (Fig. 4). SGT cells were transfected with RNAi expressing plasmids and proteins were isolated. Control cells did not have increased cleavage of caspase 8 by immunoslot blot(Fig. 9,10). In contrast, cells transfected with RNAi-uPAR, RNAi-uPA and RNAi-uPAR/uPA had increased caspase 8 cleavage (about 1.5, 2.5, 3.5 folds, respectively)(Fig. 9,10). It suggested that suppression of uPAR and uPA expression in SGT cells could cause the accumulation of cells in the sub-G0/1 phase, and activates caspase 8.

Ⅳ. DISCUSSION

Recent studies have suggested that the expression levels of urokinase-type plasminogen activator (uPA) and fibroblastic uPA receptor (uPAR) are correlated with invasiveness and metastasis of malignant tumor^18,19). Malignant tumors have the capacity to degrade the extracellular matrix(ECM) by controlled proteolysis. One proteolytic system involved in these processes is the uPA system, which consists of uPA, the uPAR, and uPA inhibitors 1 and 2, plasminogen activator inhibitor (PAI) 1 and 2²⁰⁾. By binding uPA, uPAR localizes proteolytic activity to the leading edge of cells, thereby facilitating cellular migration and penetration across tissue boundaries^21-22). uPAR also binds directly to vitronectin and associates with integrins within the plasma membrane, which alters the strength of cellular adhesion¹⁰⁾. There are 3 basic steps involved in invasion and intracellular signaling: (1) uPAR–uPA promotes extracellular proteolysis by regulating plasminogen activation, (2) uPAR–uPA regulates cell/ECM interactions as an adhesion receptor for vitronectin(Vn) and through its capacity to modulate integrin function, and (3) uPAR–uPA regulates cell migration as a signal transduction molecule and by its intrinsic chemotactic activity^18,19).

In the present study, we have attempted to retard the invasive ability and angiogenic potential of SGT cells in vitro. This study showed that both uPAR and uPA were highly expressed in SGT cells, and the expression of uPAR was always correlated with the expression of its ligand uPA. Researchers have shown that activation of the uPAR/uPA system is an early event in the development of cancer and that uPAR gene amplifications identify a subgroup of particularly aggressive tumors, thereby making the uPAR/uPA system a critical and highly promising target for therapeutic interventions²³⁾.

To target the uPAR/uPA system, we used plasmids expressing shRNA targeting uPAR and uPA^24,25-29). In this study, SGT cells transfected with RNAi-uPAR displayed markedly inhibited adhesion to vitronectin compared to control, while cells transfected with RNAi-uPAR compared to parental cells did not show difference in the ability to adhere to types I and IV collagen and laminin³⁰⁾. The direct function of uPAR might be to mediate the initial binding of cells to vitronectin as a matrix substrate, which was used for adhesion assay in this study. Thus, these results showed that inhibition of uPAR via RNA interference might also contribute to regulate the adhesion activity of SGT cells. From the Matrigel invasion assay, we observed that the simultaneous downregulation of uPAR and uPA caused a significant decrease in invasive potential as compared to cells downregulated for either uPAR or uPA. Recent research provide new functional evidence of the uPAR/uPA system's role in cancer invasion/ metastasis³¹⁾. Researchers have also shown that inhibiting the activity of the uPAR and associated molecules like integrins³²⁾ causes a significant decrease of migration and intracellular signaling in cancer cells. The uPAR/uPA system is known to be localized at the invasive front of tumor cells, activating plasmin to plasminogen and further enabling the activation of various proteases³³⁾. Previous studies have shown that uPAR interacts with the extracellular domain of integrins allowing association with the cytoskeleton, thereby mediating cell adhesion and migration^34,35). These findings confirmed that downregulation of uPAR via RNAi might decrease cell migration, possibly due to cytoskeletal alterations. Several reports indicated that expression of uPAR was essential components of the invasion process^30,36,37). In the present study, RNAi-uPAR/uPA inhibited prominently the invasiveness of SGT cells.

The classical role of the uPAR/uPA system is the activation of plasmin, and plasmin-overproducing cancer cells are also known to overexpress tPA, uPA, and uPAR. Plasmin is also known to promote angiogenesis and metastasis³⁸⁾. The mechanisms by which plasmin promotes angiogenesis and metastasis remain poorly understood. It was thought that suppressing the plasmin activating system could essentially inhibit angiogenic activation. Suppression of both uPAR and uPA retarded angiogenic activation under in vitro conditions, which meant that interference with the uPAR/uPA system retarded angiogenesis. And also simultaneous downregulation of uPAR and uPA could suppress angiogenin, MCP-1 and ENA-78 as a proangiogenic molecule, but upregulated the activity of RANTES in cancer cells^39-42). It was presented that upregulation of RANTES and downregulation of MCP-1 play a role in boosting clinical antitumor immunity⁴¹⁾. Quantitative analysis of neovasculature from the in vivo angiogenesis assay indicated that controls and control cells had similar increases in vasculature, whereas RNAi-uPAR treated cells and RNAiuPA- treated cells had decreased angiogenesis. RNAi-uPAR/ uPA treated cells exhibited little increase in vasculature.

Interestingly, the downregulation of the uPAR/uPA system also caused the activation of proapoptotic molecules like caspase 8. From FACS analysis, we did observe the accumulation of cells in the sub-G0/G1 phase in cells downregulated for uPAR and uPA either alone or in combination. In immunoslot blotting, caspase 8 activation showed that cells simultaneously downregulated for uPAR and uPA had strong caspase 8 activation, indicating that both uPAR and uPA are necessary for maintenance of a viable invasive phenotype. Immunoslot blot analysis suggests this decrease may be due to the overall shut down of cellular processes and an indicator of apoptosis. The simultaneous downregulation of uPAR and uPA caused the activation of DNA damage as shown by TUNEL assay in vivo study⁴³⁾. The tumor tissues had decreased tumor cell density and fragmented nuclei, which are both indicative of apoptosis. By immunohistochemistry in vivo, uPA expression was seen uniformly throughout the tumor tissue with little expression in the large excretory ducts, whereas uPAR expression was observed in the tumor tissues as well as in the excretory ducts⁴³⁾.

Taken together, it suggested that the targeting of the uPAR/uPA system has significant therapeutic potential for the treatment of AdCa. Because uPAR/uPA system may have certain unknown regulatory functions, further study to determine if this has any regulatory function is recommended.